Vieillot's Weaver (Ploceus nigerrimus)

Vieillot's Weaver (Ploceus nigerrimus)
×

Vieillot's Weaver (Ploceus nigerrimus)
About Vieillot's Weaver (Ploceus nigerrimus)
- Kingdom: Animals
- Phylum: Chordates
- Class: Birds
- Order: Perching Birds
- Family: Old World Sparrows
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There are 2 barcode sequences available from BOLD and GenBank.
Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.
See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
CCTATACTTAATTTTCGGCGCATGAGCTGGAATGGTAGGAACCGCCCTAAGCCTCCTCATTCGGGCAGAACTAGGCCAACCTGGAGCTCTACTAGGAGACGACCAAATCTACAACGTGGTAGTCACGGCCCATGCCTTCGTAATGATCTTCTTCATAGTCATGCCAATTATAATCGGAGGGTTCGGAAACTGACTAGTCCCCCTAATAATTGGAGCCCCAGACATAGCATTTCCACGAATAAATAACATGAGCTTCTGACTTCTCCCTCCATCCTTCCTCCTACTGCTAGCCTCTTCCACAGTAGAAGCAGGAGTAGGAACAGGATGAACCGTATACCCGCCACTAGCCGGCAACCTAGCACACGCGGGGGCCTCCGTAGACTTAGCCATCTTCTCCCTACACCTTGCAGGTATCTCTTCAATTCTAGGGGCAATCAACTTTATCACTACAGCAATCAACATAAAACCCCCTGCCCTATCACAATACCAAACCCCACTATTTGTCTGATCGGTACTTATCACTGCAGTCCTCCTCCTCCTATCCCTTCCAGTACTCGCCGCCGGAATTACAATACTGCTAACAGACCGCAACCTCAACACTACATTCTTCGACCCTGCAGGAGGAGGGGACCCAATCCTGTACCAGCACCTG
-- end --
-- end --
Download FASTA File
Barcode of Life Data Systems
Visits
-
2003-03-13Kibale National Park, Uganda
-
2017-01-01Mabamba Swamp, Uganda
-
2017-01-02Lake Mburo National Park, Uganda
-
2017-01-07Bwindi Impenetrable Forest - Buhoma, Uganda
-
2017-01-11Bigodi Swamp, Uganda
-
2017-01-11Semuliki National Park, Uganda
-
2017-01-13Fort Portal, Uganda