Planet Scott Logo
Greetings From
PLANET SCOTT
Controlling Earth's Destiny Since 1970

Vieillot's Weaver (Ploceus nigerrimus)

Vieillot's Weaver (Ploceus nigerrimus)
Vieillot's Weaver (Ploceus nigerrimus)

About Vieillot's Weaver (Ploceus nigerrimus)

  • Kingdom: Animals
  • Phylum: Chordates
  • Class: Birds
  • Order: Perching Birds
  • Family: Old World Sparrows

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATACTTAATTTTCGGCGCATGAGCTGGAATGGTAGGAACCGCCCTAAGCCTCCTCATTCGGGCAGAACTAGGCCAACCTGGAGCTCTACTAGGAGACGACCAAATCTACAACGTGGTAGTCACGGCCCATGCCTTCGTAATGATCTTCTTCATAGTCATGCCAATTATAATCGGAGGGTTCGGAAACTGACTAGTCCCCCTAATAATTGGAGCCCCAGACATAGCATTTCCACGAATAAATAACATGAGCTTCTGACTTCTCCCTCCATCCTTCCTCCTACTGCTAGCCTCTTCCACAGTAGAAGCAGGAGTAGGAACAGGATGAACCGTATACCCGCCACTAGCCGGCAACCTAGCACACGCGGGGGCCTCCGTAGACTTAGCCATCTTCTCCCTACACCTTGCAGGTATCTCTTCAATTCTAGGGGCAATCAACTTTATCACTACAGCAATCAACATAAAACCCCCTGCCCTATCACAATACCAAACCCCACTATTTGTCTGATCGGTACTTATCACTGCAGTCCTCCTCCTCCTATCCCTTCCAGTACTCGCCGCCGGAATTACAATACTGCTAACAGACCGCAACCTCAACACTACATTCTTCGACCCTGCAGGAGGAGGGGACCCAATCCTGTACCAGCACCTG
-- end --

Download FASTA File
Barcode of Life Data Systems

Lifelists

Visits

  • 2003-03-13
    Kibale National Park, Uganda
  • 2017-01-01
    Mabamba Swamp, Uganda
  • 2017-01-02
    Lake Mburo National Park, Uganda
    Image from 2017-01-02
  • 2017-01-07
    Bwindi Impenetrable Forest - Buhoma, Uganda
    Image from 2017-01-07
  • 2017-01-11
    Bigodi Swamp, Uganda
  • 2017-01-11
    Semuliki National Park, Uganda
  • 2017-01-13
    Fort Portal, Uganda