Planet Scott Logo
Greetings From
PLANET SCOTT
Controlling Earth's Destiny Since 1970

White-faced Heron (Egretta novaehollandiae)

White-faced Heron (Egretta novaehollandiae)
White-faced Heron (Egretta novaehollandiae)
White-faced Heron (Egretta novaehollandiae)
White-faced Heron (Egretta novaehollandiae)
White-faced Heron (Egretta novaehollandiae)
White-faced Heron (Egretta novaehollandiae)

About White-faced Heron (Egretta novaehollandiae)

  • Kingdom: Animals
  • Phylum: Chordates
  • Class: Birds
  • Order: Pelicans
  • Family: Herons

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CACATGTAGTAGATGACCAAATCTACAATGTGATTGTCACCGCCCATGCCTTCGTGATAATCTTCTTCATAGTAATACCAATCATAATTGGAGGGTTCGGAAACTGACTAGTACCCCTCATAATTGGCGCCCCAGATATGGCATTCCCCCGCATAAACAACATAAGTTTCTGACTCCTCCCACCCTCATTTATACTCCTACTAGCCTCATCCACAGTTGAAGCAGGAGCAGGCACAGGCTGAACAGTCTACCCACCCTTAGCCGGCAATCTAGCCCATGCTGGAGCCTCAGTCGACCTAGCCATCTTCTCCCTTCACTTAGCAGGGGTATCCTCTATCCTAGGGGCAATCAACTTCATTACAACTGCCATCAACATAAAACCTCCAACCCTATCACAATACCAAACTCCCCTATTTGTATGATCCGTCCTAATTACCGCTGTCTTACTTCTACTTTCACTCCCAGTTCTCGCTGCAGGTATTACAATACTACTAACTGATCGAAACCTAAACACCACATTCTTTGACCCTGCTGGAGGCGGTGACCCAGTCCTCTATCAGCACCTATTCTGATTTTTTGGTCACCCAGAAGTCTATATCCTAATTCTCCCTGGATTCGGAATCATCTCACATGTA
-- end --

Download FASTA File
Barcode of Life Data Systems

Lifelists

Visits

  • 2012-01-03
    Stewart Island, New Zealand
  • 2012-01-11
    Manapouri, New Zealand
  • 2012-01-13
    Otago Peninsula / Dunedin, New Zealand
  • 2012-01-20
    Kaikoura, New Zealand
  • 2012-01-29
    Miranda, New Zealand
    Image from 2012-01-29
  • 2012-11-15
    Ravenshoe, Australia
  • 2012-11-20
    Sydney - Millennium Parklands, Australia
    Image from 2012-11-20
  • 2012-11-22
    Morton National Park, Australia
  • 2012-11-23
    Wollongong Lagoon, Australia
  • 2022-05-01
    Viti Levu, Fiji
  • 2022-05-03
    Kadavu, Fiji
  • 2022-05-04
    Kadavu, Fiji
  • 2022-05-05
    Kadavu, Fiji
  • 2022-05-07
    Bouma Natiional Heritage Park - Tavoro Falls, Fiji
  • 2022-05-08
    Matei, Fiji
    Image from 2022-05-08
  • 2022-05-10
    Vanua Levu, Fiji
  • 2023-04-03
    King's Park and Botanic Garden, Australia
    Image from 2023-04-03
  • 2023-04-05
    Rottnest Island, Australia
  • 2023-04-07
    Dryandra Woodland, Australia
  • 2023-04-09
    Sterling Range National Park, Australia
  • 2023-04-12
    Lake Seppings, Australia
  • 2023-04-21
    New Beach, Australia