Black Oystercatcher (Haematopus bachmani)

Black Oystercatcher (Haematopus bachmani)

Black Oystercatcher (Haematopus bachmani)


×

Black Oystercatcher (Haematopus bachmani)

Black Oystercatcher (Haematopus bachmani)
About Black Oystercatcher (Haematopus bachmani)
- Kingdom: Animals
- Phylum: Chordates
- Class: Birds
- Order: Pelicans
- Family: Oystercatchers
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There are 4 barcode sequences available from BOLD and GenBank.
Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.
See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
NNCCTATACCTAATCTTTGGTGCATGAGCCGGCATAGTTGGTACCGCCCTTAGCTTACTTATCCGAGCAGAACTAGGCCAACCTGGAACCCTACTAGGAGACGATCAAATTTACAATGTAATCGTCACAGCCCATGCCTTTGTAATAATCTTCTTCATAGTCATACCAATTATGATCGGCGGATTCGGAAATTGATTAGTCCCGCTCATAATTGGTGCTCCTGACATAGCATTTCCTCGCATAAACAACATAAGCTTTTGACTACTACCCCCATCATTCCTACTCCTCCTTGCTTCCTCTACAGTAGAAGCAGGAGCAGGCACAGGATGAACCGTATATCCCCCCCTAGCTGGCAACCTTGCCCACGCTGGGGCCTCAGTAGATCTGGCAATCTTCTCCCTCCATCTAGCAGGTGTATCCTCTATCTTAGGCGCAATCAATTTTATCACAACCGCTATCAACATAAAACCACCCGCCCTCTCACAATACCAAACTCCCCTATTTGTATGATCCGTACTCATCACCGCTGTCCTACTACTCCTATCCTTGCCAGTTCTCGCTGCCGGCATCACAATACTCCTAACAGATCGAAACCTAAACACTACATTCTTCGATCCCGCCGGAGGTGGCGATCCAGTCCTATACCAACACCTATTCTGATTCTTCGGTCACCCAGAAGTCTATATTTTAATCCTA
-- end --
-- end --
Download FASTA File
Barcode of Life Data Systems
Visits
-
2000-12-01Bodega Bay, United States of America
-
2004-06-20Gwaai Haanas National Park, CanadaCommon.
-
2007-01-10Heron's Head Park, United States of America
-
2007-01-14Pescadero Marsh, United States of America
-
2009-11-29Heron's Head Park, United States of America
-
2012-09-07Heron's Head Park, United States of America
-
2012-09-23Heron's Head Park, United States of America
-
2013-08-18Farallones Marine Sanctuary, United States of America
-
2013-12-01Heron's Head Park, United States of America
-
2014-03-22Baker Beach, United States of America
-
2014-05-26Heron's Head Park, United States of America
-
2014-08-23MacKerricher SP, United States of America
-
2014-09-20East Wash, United States of America
-
2014-12-27Heron's Head Park, United States of America
-
2015-01-01Candlestick Park, United States of America
-
2015-01-10Half Moon Bay - Pillar Point, United States of America
-
2015-04-18Mori Pt, United States of America
-
2015-07-18Ano Nuevo State Park, United States of America
-
2016-01-24Heron's Head Park, United States of America
-
2016-11-03Heron's Head Park, United States of America
-
2016-11-25Half Moon Bay - Pillar Point, United States of America
-
2017-01-29Heron's Head Park, United States of America
-
2017-07-29Sutro Heights--Baths / Land's End, United States of America
-
2018-01-28Heron's Head Park, United States of America
-
2018-02-11Heron's Head Park, United States of America
-
2018-02-17Heron's Head Park, United States of America
-
2018-09-09India Basin Shoreline Park, United States of America
-
2018-09-23Oceano, United States of America
-
2018-10-21Heron's Head Park, United States of America
-
2018-12-28San Simeon Elephant Seals, United States of America
-
2019-11-03Heron's Head Park, United States of America
-
2020-01-26Heron's Head Park, United States of America
-
2023-01-17Heron's Head Park, United States of America
-
2023-06-27Depoe Bay, United States of America
-
2024-05-31Heron's Head Park, United States of America
-
2025-05-05Presidio - Battery Godfrey, United States of America