Planet Scott Logo
Greetings From
PLANET SCOTT
Controlling Earth's Destiny Since 1970

Black Oystercatcher (Haematopus bachmani)

Black Oystercatcher (Haematopus bachmani)
Black Oystercatcher (Haematopus bachmani)
Black Oystercatcher (Haematopus bachmani)
Black Oystercatcher (Haematopus bachmani)
Black Oystercatcher (Haematopus bachmani)
Black Oystercatcher (Haematopus bachmani)

About Black Oystercatcher (Haematopus bachmani)

  • Kingdom: Animals
  • Phylum: Chordates
  • Class: Birds
  • Order: Pelicans
  • Family: Oystercatchers

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNCCTATACCTAATCTTTGGTGCATGAGCCGGCATAGTTGGTACCGCCCTTAGCTTACTTATCCGAGCAGAACTAGGCCAACCTGGAACCCTACTAGGAGACGATCAAATTTACAATGTAATCGTCACAGCCCATGCCTTTGTAATAATCTTCTTCATAGTCATACCAATTATGATCGGCGGATTCGGAAATTGATTAGTCCCGCTCATAATTGGTGCTCCTGACATAGCATTTCCTCGCATAAACAACATAAGCTTTTGACTACTACCCCCATCATTCCTACTCCTCCTTGCTTCCTCTACAGTAGAAGCAGGAGCAGGCACAGGATGAACCGTATATCCCCCCCTAGCTGGCAACCTTGCCCACGCTGGGGCCTCAGTAGATCTGGCAATCTTCTCCCTCCATCTAGCAGGTGTATCCTCTATCTTAGGCGCAATCAATTTTATCACAACCGCTATCAACATAAAACCACCCGCCCTCTCACAATACCAAACTCCCCTATTTGTATGATCCGTACTCATCACCGCTGTCCTACTACTCCTATCCTTGCCAGTTCTCGCTGCCGGCATCACAATACTCCTAACAGATCGAAACCTAAACACTACATTCTTCGATCCCGCCGGAGGTGGCGATCCAGTCCTATACCAACACCTATTCTGATTCTTCGGTCACCCAGAAGTCTATATTTTAATCCTA
-- end --

Download FASTA File
Barcode of Life Data Systems

Visits

  • 2000-12-01
    Bodega Bay, United States of America
  • 2004-06-20
    Gwaai Haanas National Park, Canada
    Common.
  • 2007-01-10
    Heron's Head Park, United States of America
    Image from 2007-01-10
  • 2007-01-14
    Pescadero Marsh, United States of America
    Image from 2007-01-14
  • 2009-11-29
    Heron's Head Park, United States of America
  • 2012-09-07
    Heron's Head Park, United States of America
  • 2012-09-23
    Heron's Head Park, United States of America
  • 2013-08-18
    Farallones Marine Sanctuary, United States of America
  • 2013-12-01
    Heron's Head Park, United States of America
    Image from 2013-12-01
  • 2014-03-22
    Baker Beach, United States of America
  • 2014-05-26
    Heron's Head Park, United States of America
  • 2014-08-23
    MacKerricher SP, United States of America
  • 2014-09-20
    East Wash, United States of America
  • 2014-12-27
    Heron's Head Park, United States of America
  • 2015-01-01
    Candlestick Park, United States of America
  • 2015-01-10
    Half Moon Bay - Pillar Point, United States of America
  • 2015-04-18
    Mori Pt, United States of America
  • 2015-07-18
    Ano Nuevo State Park, United States of America
  • 2016-01-24
    Heron's Head Park, United States of America
  • 2016-11-03
    Heron's Head Park, United States of America
    Image from 2016-11-03
  • 2016-11-25
    Half Moon Bay - Pillar Point, United States of America
  • 2017-01-29
    Heron's Head Park, United States of America
  • 2017-07-29
    Sutro Heights--Baths / Land's End, United States of America
  • 2018-01-28
    Heron's Head Park, United States of America
  • 2018-02-11
    Heron's Head Park, United States of America
  • 2018-02-17
    Heron's Head Park, United States of America
  • 2018-09-09
    India Basin Shoreline Park, United States of America
  • 2018-09-23
    Oceano, United States of America
  • 2018-10-21
    Heron's Head Park, United States of America
  • 2018-12-28
    San Simeon Elephant Seals, United States of America
  • 2019-11-03
    Heron's Head Park, United States of America
  • 2020-01-26
    Heron's Head Park, United States of America
  • 2023-01-17
    Heron's Head Park, United States of America
  • 2023-06-27
    Depoe Bay, United States of America
  • 2024-05-31
    Heron's Head Park, United States of America
  • 2025-05-05
    Presidio - Battery Godfrey, United States of America