Planet Scott Logo
Greetings From
PLANET SCOTT
Controlling Earth's Destiny Since 1970

Grivet (Chlorocebus aethiops)

Grivet (Chlorocebus aethiops)
Grivet (Chlorocebus aethiops)

About Grivet (Chlorocebus aethiops)

  • Kingdom: Animals
  • Phylum: Chordates
  • Class: Mammals
  • Order: Primates
  • Family: Old World Monkeys

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

GGTGCATGAGCTGGAATCATAGGAACAGCTCTAAGCCTTCTCATTCGAGCTGAATTAGGCCAACCCGGTAGTTTACTAGGCAGTGACCATATCTATAATGTCATTGTAACAGCCCATGCATTTATTATAATTTTCTTCATAGTTATACCCATTATAATCGGAGGGTTCGGGAACTGACTAGTACCCTTGATAATTGGTGCTCCTGACATAGCATTTCCCCGTCTAAATAATATGAGCTTCTGACTTCTTCCCCCCTCCTTCCTGCTGCTAATGGCATCAACCATAATCGAGGCTGGCGCTGGAACAGGTTGAACAGTATACCCCCCCTTAGCAGGAAACCTCTCTCACCCAGGGGCCTCCGTAGACTTAGTTATTTTCTCCCTCCACCTAGCAGGAGTTTCCTCTATCCTGGGGGCTATCAACTTCATTACCACCATTATCAACATGAAGCCCCCCGCCATATCCCAGTATCAAACCCCGTTATTTGTCTGATCTGTCCTAATCACAGCAATCCTACTACTCCTCTCCCTGCCAGTCTTAGCTGCCGGCATTACTATACTATTAACAGACCGCAACCTCAACACTACCTTCTTTGATCCTACTGGAGGGGGAGACCCTATCCTATACCAACACCTATTT
-- end --

Download FASTA File
Barcode of Life Data Systems

Lifelists

Visits

  • 2011-01-04
    Lake Langano - Bishangari Forest, Ethiopia
  • 2011-01-06
    Lake Awasa, Ethiopia
    Very habituated monkeys around our hotel room.
    Image from 2011-01-06
  • 2011-01-12
    Wondo Genet, Ethiopia